Stem-loop sequence hsa-mir-4677

Accession MI0017308
Description Homo sapiens miR-4677 stem-loop
Stem-loop 
  a      caauu             u   c  u  ccu 
gc aagcag     guucuuuggucuu cag ca ga   g
|| ||||||     ||||||||||||| ||| || ||    
cg uucguu     caagaaaccagag guc gu cu   a
  g      -ucau             u   u  -  ucc
Get sequence
Deep sequencing
9 reads, 5 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 243509478-243509557 [+]
sense
OTTHUMT00000096488 ; SDCCAG8-004; intron 3
OTTHUMT00000096488 ; SDCCAG8-004; intron 3
OTTHUMT00000096488 ; SDCCAG8-004; intron 3
OTTHUMT00000096486 ; SDCCAG8-002; intron 7
OTTHUMT00000096486 ; SDCCAG8-002; intron 7
OTTHUMT00000096486 ; SDCCAG8-002; intron 7
OTTHUMT00000096485 ; SDCCAG8-001; intron 12
OTTHUMT00000096485 ; SDCCAG8-001; intron 12
OTTHUMT00000096485 ; SDCCAG8-001; intron 12
ENST00000493334 ; SDCCAG8-004; intron 3
ENST00000493334 ; SDCCAG8-004; intron 3
ENST00000493334 ; SDCCAG8-004; intron 3
ENST00000435549 ; SDCCAG8-002; intron 7
ENST00000435549 ; SDCCAG8-002; intron 7
ENST00000435549 ; SDCCAG8-002; intron 7
ENST00000343783 ; SDCCAG8-201; intron 9
ENST00000343783 ; SDCCAG8-201; intron 9
ENST00000343783 ; SDCCAG8-201; intron 9
ENST00000355875 ; SDCCAG8-202; intron 11
ENST00000355875 ; SDCCAG8-202; intron 11
ENST00000355875 ; SDCCAG8-202; intron 11
ENST00000366541 ; SDCCAG8-001; intron 12
ENST00000366541 ; SDCCAG8-001; intron 12
ENST00000366541 ; SDCCAG8-001; intron 12
Database links

Mature sequence hsa-miR-4677-5p

Accession MIMAT0019760
Sequence

13 -  

uuguucuuuggucuuucagcca

 - 34

Get sequence
Evidence experimental; Solexa [1,3]
Predicted targets

Mature sequence hsa-miR-4677-3p

Accession MIMAT0019761
Sequence

50 -  

ucugugagaccaaagaacuacu

 - 71

Get sequence
Deep sequencing 9 reads, 5 experiments
Evidence experimental; Solexa [1,3]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).
3
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).