Stem-loop sequence hsa-mir-4676

Accession

MI0017307

Description

Homo sapiens miR-4676 stem-loop

Stem-loop

u    g                         uuga 
 gaau aaagagccaguggugagacagugag    u
 |||| |||||||||||||||||||||||||     
 cuug uuucucggucaccacuuugucacuc    u
a    g                         uuca 

Deep sequencing

1 reads, 1 experiments

Genome context

• Coordinates (GRCh37.p5): chr10: 74480787-74480858 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000048593 ; CCDC109A-001; intron 1

  OTTHUMT00000048594 ; CCDC109A-002; intron 1

  OTTHUMT00000048593 ; CCDC109A-001; intron 1

  OTTHUMT00000048594 ; CCDC109A-002; intron 1

  OTTHUMT00000048593 ; CCDC109A-001; intron 1

  OTTHUMT00000048594 ; CCDC109A-002; intron 1

  ENST00000373053 ; MCU-002; intron 1

  ENST00000357157 ; MCU-001; intron 1

  ENST00000536019 ; MCU-201; intron 1

  ENST00000373053 ; MCU-002; intron 1

  ENST00000357157 ; MCU-001; intron 1

  ENST00000536019 ; MCU-201; intron 1

  ENST00000373053 ; MCU-002; intron 1

  ENST00000357157 ; MCU-001; intron 1

  ENST00000536019 ; MCU-201; intron 1

Database links

• ENTREZGENE: 100616286;MIR4676

Mature sequence hsa-miR-4676-5p

• Accession: MIMAT0019758
• Sequence: 10 - gagccaguggugagacaguga - 30
• Deep sequencing: 1 reads, 1 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4676-5p
  • MIRDB:hsa-miR-4676-5p
  • TARGETMINER:hsa-miR-4676-5p

Mature sequence hsa-miR-4676-3p

• Accession: MIMAT0019759
• Sequence: 44 - cacuguuucaccacuggcucuu - 65
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4676-3p
  • MIRDB:hsa-miR-4676-3p
  • TARGETMINER:hsa-miR-4676-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).