Stem-loop sequence hsa-mir-4674

Accession MI0017305
Description Homo sapiens miR-4674 stem-loop
Stem-loop 
   ag  ---   -   -      -    c   g gccg     ucc 
ccc  gc   gcc cgc ucccga ccca gcc c    ccggg   c
|||  ||   ||| ||| |||||| |||| ||| |    |||||   u
ggg  cg   cgg gcg agggcu gggu cgg g    ggccc   c
   cu  acu   c   c      c    -   a ---a     cuc
Get sequence
Deep sequencing
13 reads, 7 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr9: 139440625-139440711 [-]
antisense
OTTHUMT00000055084 ; RP11-611D20.2-001; exon 1
OTTHUMT00000055084 ; RP11-611D20.2-001; exon 1
OTTHUMT00000055084 ; RP11-611D20.2-001; exon 1
ENST00000429224 ; RP11-611D20.2-001; exon 1
ENST00000429224 ; RP11-611D20.2-001; exon 1
ENST00000429224 ; RP11-611D20.2-001; exon 1
Database links

Mature sequence hsa-miR-4674

Accession MIMAT0019756
Sequence

58 -  

cugggcucgggacgcgcggcu

 - 78

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).