Stem-loop sequence hsa-mir-4671

Accession MI0017302
Description Homo sapiens miR-4671 stem-loop
Stem-loop 
      a                        - uua 
uauuuu agaccgaagacugugcgcuaaucu c   g
|||||| |||||||||||||||||||||||| |    
auaaaa ucugguuucugauacgugauuaga g   c
      c                        a uca
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 234442213-234442285 [+]
sense
OTTHUMT00000128322 ; SLC35F3-002; intron 2
OTTHUMT00000128322 ; SLC35F3-002; intron 2
OTTHUMT00000128322 ; SLC35F3-002; intron 2
OTTHUMT00000092579 ; SLC35F3-001; intron 3
OTTHUMT00000092579 ; SLC35F3-001; intron 3
OTTHUMT00000092579 ; SLC35F3-001; intron 3
ENST00000366617 ; SLC35F3-002; intron 2
ENST00000366617 ; SLC35F3-002; intron 2
ENST00000366617 ; SLC35F3-002; intron 2
ENST00000366618 ; SLC35F3-001; intron 3
ENST00000366618 ; SLC35F3-001; intron 3
ENST00000366618 ; SLC35F3-001; intron 3
Database links

Mature sequence hsa-miR-4671-5p

Accession MIMAT0019752
Sequence

10 -  

accgaagacugugcgcuaaucu

 - 31

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4671-3p

Accession MIMAT0019753
Sequence

46 -  

uuagugcauagucuuuggucu

 - 66

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).