Stem-loop sequence hsa-mir-4670

Accession

MI0017301

Description

Homo sapiens miR-4670 stem-loop

Stem-loop

                             ca    cu 
cucuaggaagcgaccaugauguaacuuca  gacu  c
|||||||||||||||||||||||||||||  ||||  c
gagauccuucgcugguacuacauugaagu  cuga  a
                             --    aa 

Genome context

• Coordinates (GRCh37.p5): chr9: 95290266-95290340 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000053091 ; ECM2-001; intron 1

  OTTHUMT00000053092 ; ECM2-002; intron 1

  OTTHUMT00000053091 ; ECM2-001; intron 1

  OTTHUMT00000053092 ; ECM2-002; intron 1

  OTTHUMT00000053091 ; ECM2-001; intron 1

  OTTHUMT00000053092 ; ECM2-002; intron 1

  OTTHUMT00000053093 ; ECM2-003; intron 2

  OTTHUMT00000053093 ; ECM2-003; intron 2

  OTTHUMT00000053093 ; ECM2-003; intron 2

  ENST00000344604 ; ECM2-001; intron 1

  ENST00000375540 ; ECM2-002; intron 1

  ENST00000444490 ; ECM2-201; intron 1

  ENST00000344604 ; ECM2-001; intron 1

  ENST00000375540 ; ECM2-002; intron 1

  ENST00000444490 ; ECM2-201; intron 1

  ENST00000344604 ; ECM2-001; intron 1

  ENST00000375540 ; ECM2-002; intron 1

  ENST00000444490 ; ECM2-201; intron 1

  ENST00000395534 ; ECM2-003; intron 2

  ENST00000395534 ; ECM2-003; intron 2

  ENST00000395534 ; ECM2-003; intron 2

  antisense

  OTTHUMT00000053098 ; CENPP-003; intron 5

  OTTHUMT00000053098 ; CENPP-003; intron 5

  OTTHUMT00000053098 ; CENPP-003; intron 5

  ENST00000402724 ; CENPP-201; intron 4

  ENST00000402724 ; CENPP-201; intron 4

  ENST00000375587 ; CENPP-003; intron 5

  ENST00000375587 ; CENPP-003; intron 5

  ENST00000375587 ; CENPP-003; intron 5

Database links

• ENTREZGENE: 100616351;MIR4670

Mature sequence hsa-miR-4670-5p

• Accession: MIMAT0019750
• Sequence: 8 - aagcgaccaugauguaacuuca - 29
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4670-5p
  • MIRDB:hsa-miR-4670-5p
  • TARGETMINER:hsa-miR-4670-5p

Mature sequence hsa-miR-4670-3p

• Accession: MIMAT0019751
• Sequence: 47 - ugaaguuacaucauggucgcuu - 68
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4670-3p
  • MIRDB:hsa-miR-4670-3p
  • TARGETMINER:hsa-miR-4670-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).