Stem-loop sequence hsa-mir-4669

Accession

MI0017300

Description

Homo sapiens miR-4669 stem-loop

Stem-loop

   uc              c  uc      u 
gcc  ccuucacuuccugg ca  caggca c
|||  |||||||||||||| ||  ||||||  
cgg  ggaggugaagggcc gu  gucugu u
   ga              u  --      g 

Deep sequencing

7 reads, 4 experiments

Genome context

• Coordinates (GRCh37.p5): chr9: 137271257-137271318 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000054949 ; RXRA-002; intron 1

  OTTHUMT00000054949 ; RXRA-002; intron 1

  OTTHUMT00000054949 ; RXRA-002; intron 1

  OTTHUMT00000054948 ; RXRA-001; intron 2

  OTTHUMT00000054950 ; RXRA-003; intron 2

  OTTHUMT00000054948 ; RXRA-001; intron 2

  OTTHUMT00000054950 ; RXRA-003; intron 2

  OTTHUMT00000054948 ; RXRA-001; intron 2

  OTTHUMT00000054950 ; RXRA-003; intron 2

  ENST00000481739 ; RXRA-002; intron 1

  ENST00000481739 ; RXRA-002; intron 1

  ENST00000481739 ; RXRA-002; intron 1

  ENST00000484822 ; RXRA-003; intron 2

  ENST00000356384 ; RXRA-001; intron 2

  ENST00000484822 ; RXRA-003; intron 2

  ENST00000356384 ; RXRA-001; intron 2

  ENST00000484822 ; RXRA-003; intron 2

  ENST00000356384 ; RXRA-001; intron 2

Database links

• ENTREZGENE: 100616236;MIR4669

Mature sequence hsa-miR-4669

• Accession: MIMAT0019749
• Sequence: 39 - uguguccgggaaguggaggagg - 60
• Deep sequencing: 6 reads, 3 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4669
  • MIRDB:hsa-miR-4669
  • TARGETMINER:hsa-miR-4669

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).