|
miRBase |
|
Stem-loop sequence hsa-mir-4668 |
|||||
| Accession | MI0017298 | ||||
| Description | Homo sapiens miR-4668 stem-loop | ||||
| Stem-loop |
-a a g guagc g gggaaaa aaaaaggauuu ucuu cag a ||||||| ||||||||||| |||| ||| ccuuuuu uuuuuccuaaa agaa guu u ga g - auuuu a |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4668-5p |
|
| Accession | MIMAT0019745 |
| Sequence |
1 - agggaaaaaaaaaaggauuuguc - 23 |
| Deep sequencing | 8 reads, 7 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
Mature sequence hsa-miR-4668-3p |
|
| Accession | MIMAT0019746 |
| Sequence |
48 - gaaaauccuuuuuguuuuuccag - 70 |
| Deep sequencing | 1 reads, 1 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|