Stem-loop sequence hsa-mir-4667

Accession MI0017297
Description Homo sapiens miR-4667 stem-loop
Gene family MIPF0001390; mir-4667
Stem-loop 
ugac      g         --aa -     aaa 
    ugggga cagaaggag    c ccaag   a
    |||||| |||||||||    | |||||   g
    accccu gucuuccuc    g gguuc   c
-gac      -         ccug a     agu
Get sequence
Deep sequencing
20 reads, 5 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr9: 35608091-35608156 [+]
sense
OTTHUMT00000052318 ; TESK1-005; intron 1
OTTHUMT00000052318 ; TESK1-005; intron 1
OTTHUMT00000052318 ; TESK1-005; intron 1
OTTHUMT00000052317 ; TESK1-004; intron 2
OTTHUMT00000052317 ; TESK1-004; intron 2
OTTHUMT00000052317 ; TESK1-004; intron 2
OTTHUMT00000052316 ; TESK1-003; intron 3
OTTHUMT00000052316 ; TESK1-003; intron 3
OTTHUMT00000052316 ; TESK1-003; intron 3
OTTHUMT00000052315 ; TESK1-002; intron 6
OTTHUMT00000052315 ; TESK1-002; intron 6
OTTHUMT00000052315 ; TESK1-002; intron 6
OTTHUMT00000052314 ; TESK1-001; intron 7
OTTHUMT00000052314 ; TESK1-001; intron 7
OTTHUMT00000052314 ; TESK1-001; intron 7
ENST00000480077 ; TESK1-005; intron 1
ENST00000480077 ; TESK1-005; intron 1
ENST00000480077 ; TESK1-005; intron 1
ENST00000463897 ; TESK1-004; intron 2
ENST00000463897 ; TESK1-004; intron 2
ENST00000463897 ; TESK1-004; intron 2
ENST00000467424 ; TESK1-003; intron 3
ENST00000467424 ; TESK1-003; intron 3
ENST00000467424 ; TESK1-003; intron 3
ENST00000498522 ; TESK1-002; intron 6
ENST00000498522 ; TESK1-002; intron 6
ENST00000498522 ; TESK1-002; intron 6
ENST00000336395 ; TESK1-001; intron 7
ENST00000535770 ; TESK1-201; intron 7
ENST00000336395 ; TESK1-001; intron 7
ENST00000535770 ; TESK1-201; intron 7
ENST00000336395 ; TESK1-001; intron 7
Database links

Mature sequence hsa-miR-4667-5p

Accession MIMAT0019743
Sequence

3 -  

acuggggagcagaaggagaacc

 - 24

Get sequence
Deep sequencing 20 reads, 5 experiments
Evidence experimental; Solexa [1-2]
Predicted targets

Mature sequence hsa-miR-4667-3p

Accession MIMAT0019744
Sequence

46 -  

ucccuccuucuguccccacag

 - 66

Get sequence
Evidence experimental; Solexa [1-2]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).