Stem-loop sequence hsa-mir-4665

Accession MI0017295
Description Homo sapiens miR-4665 stem-loop
Stem-loop 
     g   c      --      ga   --       cuu 
cucga gug uggggg  acgcgu  gcg  cgagccg   c
||||| ||| ||||||  ||||||  |||  |||||||    
gggcu cac gccccc  ugcgcg  cgc  gcucggc   c
     a   c      ga      -g   cg       acu
Get sequence
Deep sequencing
5 reads, 2 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr9: 6007826-6007904 [+]
antisense
OTTHUMT00000400996 ; RP11-546N22.7-003; 5'UTR (exon 1)
OTTHUMT00000400996 ; RP11-546N22.7-003; 5'UTR (exon 1)
OTTHUMT00000400996 ; RP11-546N22.7-003; 5'UTR (exon 1)
ENST00000513355 ; KIAA2026-003; 5'UTR (exon 1)
ENST00000513355 ; KIAA2026-003; 5'UTR (exon 1)
ENST00000513355 ; KIAA2026-003; 5'UTR (exon 1)
Database links

Mature sequence hsa-miR-4665-5p

Accession MIMAT0019739
Sequence

10 -  

cugggggacgcgugagcgcgagc

 - 32

Get sequence
Deep sequencing 5 reads, 2 experiments
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4665-3p

Accession MIMAT0019740
Sequence

46 -  

cucggccgcggcgcguagcccccgcc

 - 71

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).