|
miRBase |
|
Stem-loop sequence hsa-mir-4662a |
||||||
| Accession | MI0017290 | |||||
| Description | Homo sapiens miR-4662a stem-loop | |||||
| Gene family | MIPF0001245; mir-4662 | |||||
| Stem-loop |
c c u ucuauuuagccaauuguc aucuuuag uau c |||||||||||||||||| |||||||| ||| u agauaaaucgguuaacag uagaaauc gua g a c a |
|||||
| Deep sequencing |
| |||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links |
|
|||||
Mature sequence hsa-miR-4662a-5p |
|
| Accession | MIMAT0019731 |
| Sequence |
6 - uuagccaauuguccaucuuuag - 27 |
| Evidence | experimental; Solexa [1,3] |
| Predicted targets |
|
Mature sequence hsa-miR-4662a-3p |
|
| Accession | MIMAT0019732 |
| Sequence |
43 - aaagauagacaauuggcuaaau - 64 |
| Deep sequencing | 2 reads, 2 experiments |
| Evidence | experimental; Solexa [1,3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
| 2 |
PMID:21911355
"miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades"
Nucleic Acids Res. 40:37-52(2012).
|
| 3 |
PMID:21807764
"Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome"
Hum Mol Genet. 20:4025-4040(2011).
|