Stem-loop sequence hsa-mir-4661

Accession MI0017289
Description Homo sapiens miR-4661 stem-loop
Stem-loop 
u        a                   ----a   a 
 uuacucug acuagcucuguggauccug     cag c
 |||||||| |||||||||||||||||||     ||| a
 aaugagac ugaucgagacaccuaggac     guc g
a        c                   agaua   c
Get sequence
Deep sequencing
2 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr8: 92217713-92217787 [+]
sense
OTTHUMT00000376790 ; LRRC69-001; intron 3
OTTHUMT00000376790 ; LRRC69-001; intron 3
OTTHUMT00000376790 ; LRRC69-001; intron 3
OTTHUMT00000415207 ; LRRC69-007; intron 7
OTTHUMT00000415207 ; LRRC69-007; intron 7
OTTHUMT00000415207 ; LRRC69-007; intron 7
OTTHUMT00000376888 ; LRRC69-002; intron 9
OTTHUMT00000376888 ; LRRC69-002; intron 9
OTTHUMT00000376888 ; LRRC69-002; intron 9
ENST00000343709 ; LRRC69-001; intron 3
ENST00000343709 ; LRRC69-001; intron 3
ENST00000343709 ; LRRC69-001; intron 3
ENST00000448384 ; LRRC69-007; intron 7
ENST00000448384 ; LRRC69-007; intron 7
ENST00000448384 ; LRRC69-007; intron 7
ENST00000520099 ; LRRC69-002; intron 9
ENST00000520099 ; LRRC69-002; intron 9
ENST00000520099 ; LRRC69-002; intron 9
Database links

Mature sequence hsa-miR-4661-5p

Accession MIMAT0019729
Sequence

10 -  

aacuagcucuguggauccugac

 - 31

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4661-3p

Accession MIMAT0019730
Sequence

47 -  

caggauccacagagcuagucca

 - 68

Get sequence
Deep sequencing 2 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).