Stem-loop sequence hsa-mir-4660

Accession MI0017288
Description Homo sapiens miR-4660 stem-loop
Gene family MIPF0001460; mir-4660
Stem-loop 
     u  ugca       u   aa      --   ac 
acucc uc    gcucugg gga  auggag  aag  u
||||| ||    ||||||| |||  ||||||  |||  u
ugagg gg    cgggacc ccu  uaccuc  uuc  u
     u  --uc       c   -c      cu   cu
Get sequence
Deep sequencing
3 reads, 3 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr8: 8905955-8906028 [+]
sense
OTTHUMT00000374782 ; ERI1-008; intron 1
OTTHUMT00000374782 ; ERI1-008; intron 1
OTTHUMT00000374782 ; ERI1-008; intron 1
OTTHUMT00000374781 ; ERI1-006; intron 3
OTTHUMT00000374781 ; ERI1-006; intron 3
OTTHUMT00000374781 ; ERI1-006; intron 3
OTTHUMT00000374780 ; ERI1-007; intron 4
OTTHUMT00000374780 ; ERI1-007; intron 4
OTTHUMT00000374780 ; ERI1-007; intron 4
ENST00000522612 ; ERI1-008; intron 1
ENST00000522612 ; ERI1-008; intron 1
ENST00000522612 ; ERI1-008; intron 1
ENST00000518663 ; ERI1-006; intron 3
ENST00000518663 ; ERI1-006; intron 3
ENST00000518663 ; ERI1-006; intron 3
ENST00000520332 ; ERI1-007; intron 4
ENST00000520332 ; ERI1-007; intron 4
ENST00000520332 ; ERI1-007; intron 4
Database links

Mature sequence hsa-miR-4660

Accession MIMAT0019728
Sequence

9 -  

ugcagcucugguggaaaauggag

 - 31

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).