Stem-loop sequence hsa-mir-4659a

Accession MI0017287
Description Homo sapiens miR-4659a stem-loop
Gene family MIPF0001256; mir-4659
Stem-loop 
       c   a c                    c   g 
gaaacug uga g ugccaugucuaagaagaaaa uuu g
||||||| ||| | |||||||||||||||||||| ||| a
cuuugac acu c acgguacagauucuucuuuu aaa g
       a   g a                    a   a
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr8: 6602685-6602765 [+]
sense
OTTHUMT00000374686 ; AGPAT5-003; intron 1
OTTHUMT00000374686 ; AGPAT5-003; intron 1
OTTHUMT00000374686 ; AGPAT5-003; intron 1
OTTHUMT00000381879 ; AGPAT5-006; intron 2
OTTHUMT00000381879 ; AGPAT5-006; intron 2
OTTHUMT00000381879 ; AGPAT5-006; intron 2
OTTHUMT00000374685 ; AGPAT5-002; intron 4
OTTHUMT00000374685 ; AGPAT5-002; intron 4
OTTHUMT00000374685 ; AGPAT5-002; intron 4
OTTHUMT00000374684 ; AGPAT5-001; intron 5
OTTHUMT00000374684 ; AGPAT5-001; intron 5
OTTHUMT00000374684 ; AGPAT5-001; intron 5
ENST00000518327 ; AGPAT5-003; intron 1
ENST00000518327 ; AGPAT5-003; intron 1
ENST00000518327 ; AGPAT5-003; intron 1
ENST00000530716 ; AGPAT5-006; intron 2
ENST00000530716 ; AGPAT5-006; intron 2
ENST00000530716 ; AGPAT5-006; intron 2
ENST00000523234 ; AGPAT5-002; intron 4
ENST00000523234 ; AGPAT5-002; intron 4
ENST00000523234 ; AGPAT5-002; intron 4
ENST00000285518 ; AGPAT5-001; intron 5
ENST00000285518 ; AGPAT5-001; intron 5
ENST00000285518 ; AGPAT5-001; intron 5
Clustered miRNAs
< 10kb from hsa-mir-4659a
hsa-mir-4659a chr8: 6602685-6602765 [+]
hsa-mir-4659b chr8: 6602689-6602761 [-]
Database links

Mature sequence hsa-miR-4659a-5p

Accession MIMAT0019726
Sequence

14 -  

cugccaugucuaagaagaaaac

 - 35

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4659a-3p

Accession MIMAT0019727
Sequence

49 -  

uuucuucuuagacauggcaacg

 - 70

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).