Stem-loop sequence hsa-mir-4658

Accession

MI0017286

Description

Homo sapiens miR-4658 stem-loop

Stem-loop

  ug cc   a   ag  c        c   u 
gc  c  uuc cuc  ag aucuacac cac a
||  |  ||| |||  || |||||||| ||| c
cg  g  aag gag  uc uaggugug gug c
  gu cu   -   -g  c        a   g 

Genome context

• Coordinates (GRCh37.p5): chr7: 99754228-99754292 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000337411 ; C7orf43-006; intron 3

  OTTHUMT00000337499 ; C7orf43-012; intron 3

  OTTHUMT00000337411 ; C7orf43-006; intron 3

  OTTHUMT00000337499 ; C7orf43-012; intron 3

  OTTHUMT00000337411 ; C7orf43-006; intron 3

  OTTHUMT00000337499 ; C7orf43-012; intron 3

  OTTHUMT00000337410 ; C7orf43-005; intron 5

  OTTHUMT00000337410 ; C7orf43-005; intron 5

  OTTHUMT00000337410 ; C7orf43-005; intron 5

  OTTHUMT00000337497 ; C7orf43-010; intron 6

  OTTHUMT00000337409 ; C7orf43-004; intron 6

  OTTHUMT00000337497 ; C7orf43-010; intron 6

  OTTHUMT00000337409 ; C7orf43-004; intron 6

  OTTHUMT00000337497 ; C7orf43-010; intron 6

  OTTHUMT00000337409 ; C7orf43-004; intron 6

  OTTHUMT00000337395 ; C7orf43-001; intron 7

  OTTHUMT00000337425 ; C7orf43-008; intron 7

  OTTHUMT00000337395 ; C7orf43-001; intron 7

  OTTHUMT00000337425 ; C7orf43-008; intron 7

  OTTHUMT00000337395 ; C7orf43-001; intron 7

  OTTHUMT00000337425 ; C7orf43-008; intron 7

  ENST00000448720 ; C7orf43-006; intron 3

  ENST00000498638 ; C7orf43-012; intron 3

  ENST00000498638 ; C7orf43-012; intron 3

  ENST00000448720 ; C7orf43-006; intron 3

  ENST00000448720 ; C7orf43-006; intron 3

  ENST00000498638 ; C7orf43-012; intron 3

  ENST00000419841 ; C7orf43-005; intron 5

  ENST00000419841 ; C7orf43-005; intron 5

  ENST00000419841 ; C7orf43-005; intron 5

  ENST00000457641 ; C7orf43-010; intron 6

  ENST00000419037 ; C7orf43-004; intron 6

  ENST00000419037 ; C7orf43-004; intron 6

  ENST00000457641 ; C7orf43-010; intron 6

  ENST00000457641 ; C7orf43-010; intron 6

  ENST00000419037 ; C7orf43-004; intron 6

  ENST00000316937 ; C7orf43-001; intron 7

  ENST00000456769 ; C7orf43-008; intron 7

  ENST00000456769 ; C7orf43-008; intron 7

  ENST00000316937 ; C7orf43-001; intron 7

  ENST00000316937 ; C7orf43-001; intron 7

  ENST00000456769 ; C7orf43-008; intron 7

Database links

• ENTREZGENE: 100616439;MIR4658

Mature sequence hsa-miR-4658

• Accession: MIMAT0019725
• Sequence: 37 - gugaguguggauccuggaggaau - 59
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4658
  • MIRDB:hsa-miR-4658
  • TARGETMINER:hsa-miR-4658

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).