Stem-loop sequence hsa-mir-4656

Accession MI0017284
Description Homo sapiens miR-4656 stem-loop
Stem-loop 
      -  g      g   --            u  c 
aggcug gc ugggcu agg  gcaggaggccug gg c
|||||| || |||||| |||  |||||||||||| || g
uuuggc cg acucgg ucc  cguccuccggac cc g
      u  g      g   uu            -  u
Get sequence
Deep sequencing
3 reads, 3 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 4828196-4828270 [-]
antisense
OTTHUMT00000323774 ; AC092610.9-004; exon 1
OTTHUMT00000323774 ; AC092610.9-004; exon 1
OTTHUMT00000323774 ; AC092610.9-004; exon 1
OTTHUMT00000323777 ; AC092610.9-007; intron 3
OTTHUMT00000323777 ; AC092610.9-007; intron 3
OTTHUMT00000323777 ; AC092610.9-007; intron 3
OTTHUMT00000323772 ; AC092610.9-002; intron 10
OTTHUMT00000323772 ; AC092610.9-002; intron 10
OTTHUMT00000323772 ; AC092610.9-002; intron 10
OTTHUMT00000323771 ; AC092610.9-001; intron 12
OTTHUMT00000323773 ; AC092610.9-003; intron 12
OTTHUMT00000323771 ; AC092610.9-001; intron 12
OTTHUMT00000323773 ; AC092610.9-003; intron 12
OTTHUMT00000323771 ; AC092610.9-001; intron 12
OTTHUMT00000323773 ; AC092610.9-003; intron 12
ENST00000469614 ; KIAA0415-004; exon 1
ENST00000469614 ; AP5Z1-004; exon 1
ENST00000469614 ; AP5Z1-004; exon 1
ENST00000477454 ; KIAA0415-007; intron 3
ENST00000477454 ; AP5Z1-007; intron 3
ENST00000477454 ; AP5Z1-007; intron 3
ENST00000477680 ; KIAA0415-002; intron 10
ENST00000477680 ; AP5Z1-002; intron 10
ENST00000477680 ; AP5Z1-002; intron 10
ENST00000348624 ; KIAA0415-001; intron 12
ENST00000496303 ; KIAA0415-003; intron 12
ENST00000401897 ; KIAA0415-201; intron 12
ENST00000348624 ; AP5Z1-001; intron 12
ENST00000496303 ; AP5Z1-003; intron 12
ENST00000401897 ; AP5Z1-201; intron 12
ENST00000348624 ; AP5Z1-001; intron 12
ENST00000496303 ; AP5Z1-003; intron 12
ENST00000401897 ; AP5Z1-201; intron 12
Database links

Mature sequence hsa-miR-4656

Accession MIMAT0019723
Sequence

10 -  

ugggcugagggcaggaggccugu

 - 32

Get sequence
Deep sequencing 3 reads, 3 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).