Stem-loop sequence hsa-mir-4655

Accession

MI0017283

Description

Homo sapiens miR-4655 stem-loop

Stem-loop

   a    a a       --    a        uggg 
cca gggc c ccgggga  uggc gagggucg    a
||| |||| | |||||||  |||| ||||||||    a
ggu cccg g ggccccu  acug cucccagu    a
   c    a g       gg    -        ugug 

Deep sequencing

10 reads, 7 experiments

Genome context

• Coordinates (GRCh37.p5): chr7: 1883816-1883889 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000322887 ; MAD1L1-019; intron 1

  OTTHUMT00000322887 ; MAD1L1-019; intron 1

  OTTHUMT00000322887 ; MAD1L1-019; intron 1

  OTTHUMT00000322885 ; MAD1L1-017; intron 5

  OTTHUMT00000322885 ; MAD1L1-017; intron 5

  OTTHUMT00000322885 ; MAD1L1-017; intron 5

  OTTHUMT00000322870 ; MAD1L1-002; intron 16

  OTTHUMT00000322870 ; MAD1L1-002; intron 16

  OTTHUMT00000322870 ; MAD1L1-002; intron 16

  OTTHUMT00000322869 ; MAD1L1-001; intron 18

  OTTHUMT00000322871 ; MAD1L1-003; intron 18

  OTTHUMT00000322869 ; MAD1L1-001; intron 18

  OTTHUMT00000322871 ; MAD1L1-003; intron 18

  OTTHUMT00000322869 ; MAD1L1-001; intron 18

  OTTHUMT00000322871 ; MAD1L1-003; intron 18

  ENST00000481633 ; MAD1L1-019; intron 1

  ENST00000481633 ; MAD1L1-019; intron 1

  ENST00000481633 ; MAD1L1-019; intron 1

  ENST00000450235 ; MAD1L1-017; intron 5

  ENST00000442131 ; MAD1L1-202; intron 5

  ENST00000450235 ; MAD1L1-017; intron 5

  ENST00000442131 ; MAD1L1-202; intron 5

  ENST00000450235 ; MAD1L1-017; intron 5

  ENST00000402746 ; MAD1L1-002; intron 16

  ENST00000402746 ; MAD1L1-002; intron 16

  ENST00000402746 ; MAD1L1-002; intron 16

  ENST00000265854 ; MAD1L1-201; intron 17

  ENST00000265854 ; MAD1L1-201; intron 17

  ENST00000265854 ; MAD1L1-201; intron 17

  ENST00000399654 ; MAD1L1-001; intron 18

  ENST00000406869 ; MAD1L1-003; intron 18

  ENST00000399654 ; MAD1L1-001; intron 18

  ENST00000406869 ; MAD1L1-003; intron 18

  ENST00000399654 ; MAD1L1-001; intron 18

  ENST00000406869 ; MAD1L1-003; intron 18

  antisense

  OTTHUMT00000322896 ; AC110781.3-001; intron 1

  OTTHUMT00000322896 ; AC110781.3-001; intron 1

  OTTHUMT00000322896 ; AC110781.3-001; intron 1

  ENST00000402221 ; AC110781.3-001; intron 1

  ENST00000318959 ; AC110781.3-201; intron 1

  ENST00000402221 ; AC110781.3-001; intron 1

  ENST00000318959 ; AC110781.3-201; intron 1

  ENST00000402221 ; AC110781.3-001; intron 1

  ENST00000318959 ; AC110781.3-201; intron 1

Database links

• ENTREZGENE: 100616160;MIR4655

Mature sequence hsa-miR-4655-5p

• Accession: MIMAT0019721
• Sequence: 10 - caccggggauggcagagggucg - 31
• Deep sequencing: 4 reads, 2 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4655-5p
  • MIRDB:hsa-miR-4655-5p
  • TARGETMINER:hsa-miR-4655-5p

Mature sequence hsa-miR-4655-3p

• Accession: MIMAT0019722
• Sequence: 45 - acccucgucagguccccgggg - 65
• Deep sequencing: 5 reads, 4 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4655-3p
  • MIRDB:hsa-miR-4655-3p
  • TARGETMINER:hsa-miR-4655-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).