Stem-loop sequence hsa-mir-4654

Accession MI0017282
Description Homo sapiens miR-4654 stem-loop
Gene family MIPF0001507; mir-4654
Stem-loop 
     u   --  u    ucu      auc       gg 
cuggc ggu  ug ggga   ggaggc   ugggguu  a
||||| |||  || ||||   ||||||   |||||||  a
gaccg cua  ac cccu   ccucug   accccag  u
     u   cu  u    uuu      ---       ug
Get sequence
Deep sequencing
14 reads, 7 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 162126897-162126972 [+]
sense
OTTHUMT00000382762 ; NOS1AP-008; intron 2
OTTHUMT00000060555 ; NOS1AP-001; intron 2
OTTHUMT00000382763 ; NOS1AP-009; intron 2
OTTHUMT00000382762 ; NOS1AP-008; intron 2
OTTHUMT00000060555 ; NOS1AP-001; intron 2
OTTHUMT00000382763 ; NOS1AP-009; intron 2
OTTHUMT00000382762 ; NOS1AP-008; intron 2
OTTHUMT00000060555 ; NOS1AP-001; intron 2
OTTHUMT00000382763 ; NOS1AP-009; intron 2
ENST00000530878 ; NOS1AP-008; intron 2
ENST00000361897 ; NOS1AP-001; intron 2
ENST00000430120 ; NOS1AP-009; intron 2
ENST00000530878 ; NOS1AP-008; intron 2
ENST00000361897 ; NOS1AP-001; intron 2
ENST00000430120 ; NOS1AP-009; intron 2
ENST00000530878 ; NOS1AP-008; intron 2
ENST00000361897 ; NOS1AP-001; intron 2
ENST00000430120 ; NOS1AP-009; intron 2
Database links

Mature sequence hsa-miR-4654

Accession MIMAT0019720
Sequence

10 -  

ugugggaucuggaggcaucugg

 - 31

Get sequence
Deep sequencing 11 reads, 5 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).