Stem-loop sequence hsa-mir-4653

Accession MI0017281
Description Homo sapiens miR-4653 stem-loop
Stem-loop 
u g          ug     gg      a   aa    uaa 
 u uccaauucuc  agcaa  cuuaac cca  gggu   g
 | ||||||||||  |||||  |||||| |||  ||||   g
 a agguuaagag  ucguu  gaauug ggu  cucg   g
a g          gu     gg      a   --    uuu
Get sequence
Deep sequencing
14 reads, 3 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 100802754-100802836 [+]
sense
OTTHUMT00000347439 ; AP1S1-001; intron 4
OTTHUMT00000347441 ; AP1S1-003; intron 4
OTTHUMT00000347442 ; AP1S1-004; intron 4
OTTHUMT00000347439 ; AP1S1-001; intron 4
OTTHUMT00000347441 ; AP1S1-003; intron 4
OTTHUMT00000347442 ; AP1S1-004; intron 4
OTTHUMT00000347439 ; AP1S1-001; intron 4
OTTHUMT00000347441 ; AP1S1-003; intron 4
OTTHUMT00000347442 ; AP1S1-004; intron 4
ENST00000337619 ; AP1S1-001; intron 4
ENST00000443943 ; AP1S1-003; intron 4
ENST00000429457 ; AP1S1-004; intron 4
ENST00000337619 ; AP1S1-001; intron 4
ENST00000443943 ; AP1S1-003; intron 4
ENST00000429457 ; AP1S1-004; intron 4
ENST00000337619 ; AP1S1-001; intron 4
ENST00000443943 ; AP1S1-003; intron 4
ENST00000429457 ; AP1S1-004; intron 4
Database links

Mature sequence hsa-miR-4653-5p

Accession MIMAT0019718
Sequence

10 -  

ucucugagcaaggcuuaacacc

 - 31

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4653-3p

Accession MIMAT0019719
Sequence

52 -  

uggaguuaaggguugcuuggaga

 - 74

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).