|
miRBase |
|
Stem-loop sequence hsa-mir-4650-2 |
|||||
| Accession | MI0017278 | ||||
| Description | Homo sapiens miR-4650-2 stem-loop | ||||
| Gene family | MIPF0001234; mir-4650 | ||||
| Stem-loop |
gauua u caa uucuguaga ucaggccuc uucuaccuuc g ||||||||| ||||||||| |||||||||| g aggacgucu aguccggag aagauggaag c -auac u acu |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4650-5p |
|
| Accession | MIMAT0019713 |
| Sequence |
15 - ucaggccucuuucuaccuu - 33 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
Mature sequence hsa-miR-4650-3p |
|
| Accession | MIMAT0019714 |
| Sequence |
46 - agguagaaugaggccugacau - 66 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|