Stem-loop sequence hsa-mir-4650-1

Accession MI0017277
Description Homo sapiens miR-4650-1 stem-loop
Gene family MIPF0001234; mir-4650
Stem-loop 
         gauua         u          caa 
uucuguaga     ucaggccuc uucuaccuuc   g
|||||||||     ||||||||| ||||||||||   g
aggacgucu     aguccggag aagauggaag   c
         -auac         u          acu
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 66579309-66579384 [-]
antisense
OTTHUMT00000346625 ; TYW1-008; intron 2
OTTHUMT00000346625 ; TYW1-008; intron 2
OTTHUMT00000346625 ; TYW1-008; intron 2
OTTHUMT00000346624 ; TYW1-007; intron 3
OTTHUMT00000346624 ; TYW1-007; intron 3
OTTHUMT00000346624 ; TYW1-007; intron 3
OTTHUMT00000346623 ; TYW1-006; intron 8
OTTHUMT00000346623 ; TYW1-006; intron 8
OTTHUMT00000346623 ; TYW1-006; intron 8
OTTHUMT00000346621 ; TYW1-004; intron 10
OTTHUMT00000346621 ; TYW1-004; intron 10
OTTHUMT00000346621 ; TYW1-004; intron 10
OTTHUMT00000346619 ; TYW1-002; intron 11
OTTHUMT00000346619 ; TYW1-002; intron 11
OTTHUMT00000346619 ; TYW1-002; intron 11
OTTHUMT00000251932 ; TYW1-001; intron 12
OTTHUMT00000251932 ; TYW1-001; intron 12
OTTHUMT00000251932 ; TYW1-001; intron 12
ENST00000468566 ; TYW1-008; intron 2
ENST00000468566 ; TYW1-008; intron 2
ENST00000468566 ; TYW1-008; intron 2
ENST00000495971 ; TYW1-007; intron 3
ENST00000495971 ; TYW1-007; intron 3
ENST00000495971 ; TYW1-007; intron 3
ENST00000445198 ; TYW1-006; intron 8
ENST00000445198 ; TYW1-006; intron 8
ENST00000445198 ; TYW1-006; intron 8
ENST00000389196 ; TYW1-004; intron 10
ENST00000389196 ; TYW1-004; intron 10
ENST00000389196 ; TYW1-004; intron 10
ENST00000361660 ; TYW1-002; intron 11
ENST00000361660 ; TYW1-002; intron 11
ENST00000361660 ; TYW1-002; intron 11
ENST00000359626 ; TYW1-001; intron 12
ENST00000359626 ; TYW1-001; intron 12
ENST00000359626 ; TYW1-001; intron 12
Database links

Mature sequence hsa-miR-4650-5p

Accession MIMAT0019713
Sequence

15 -  

ucaggccucuuucuaccuu

 - 33

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4650-3p

Accession MIMAT0019714
Sequence

46 -  

agguagaaugaggccugacau

 - 66

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).