Stem-loop sequence hsa-mir-4647

Accession MI0017274
Description Homo sapiens miR-4647 stem-loop
Stem-loop 
       g   -a  a     cu      a  aaa    aug 
ccaggag gug  ag uggug  gugcug gg   gggg   c
||||||| |||  || |||||  |||||| ||   ||||    
gguccuc uau  uc accac  cacgac cc   uccc   a
       g   cc  c     --      -  --g    gag
Get sequence
Deep sequencing
138 reads, 14 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr6: 44221943-44222022 [-]
sense
OTTHUMT00000040723 ; SLC35B2-001; exon 3
OTTHUMT00000040725 ; SLC35B2-003; 3'UTR (exon 3)
OTTHUMT00000040723 ; SLC35B2-001; exon 3
OTTHUMT00000040725 ; SLC35B2-003; 3'UTR (exon 3)
OTTHUMT00000040723 ; SLC35B2-001; exon 3
OTTHUMT00000040725 ; SLC35B2-003; 3'UTR (exon 3)
OTTHUMT00000040724 ; SLC35B2-002; 3'UTR (exon 4)
OTTHUMT00000040724 ; SLC35B2-002; 3'UTR (exon 4)
OTTHUMT00000040724 ; SLC35B2-002; 3'UTR (exon 4)
ENST00000495706 ; SLC35B2-001; exon 3
ENST00000393810 ; SLC35B2-003; 3'UTR (exon 3)
ENST00000495706 ; SLC35B2-001; exon 3
ENST00000393810 ; SLC35B2-003; 3'UTR (exon 3)
ENST00000495706 ; SLC35B2-001; exon 3
ENST00000393810 ; SLC35B2-003; 3'UTR (exon 3)
ENST00000393812 ; SLC35B2-002; 3'UTR (exon 4)
ENST00000393812 ; SLC35B2-002; 3'UTR (exon 4)
ENST00000393812 ; SLC35B2-002; 3'UTR (exon 4)
Database links

Mature sequence hsa-miR-4647

Accession MIMAT0019709
Sequence

11 -  

gaagauggugcugugcugaggaa

 - 33

Get sequence
Deep sequencing 136 reads, 12 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).