|
miRBase |
|
Stem-loop sequence hsa-mir-4646 |
|||||
| Accession | MI0017273 | ||||
| Description | Homo sapiens miR-4646 stem-loop | ||||
| Stem-loop |
a a gcu u cg a cugggaag gga gagggaca ug gag g |||||||| ||| |||||||| || ||| g gacccuuc ccu cucccugu ac cuc g - - --- u -a u |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4646-5p |
|
| Accession | MIMAT0019707 |
| Sequence |
1 - acugggaagaggagcugaggga - 22 |
| Deep sequencing | 3 reads, 3 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
Mature sequence hsa-miR-4646-3p |
|
| Accession | MIMAT0019708 |
| Sequence |
43 - auugucccucucccuucccag - 63 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|