Stem-loop sequence hsa-mir-4646

Accession MI0017273
Description Homo sapiens miR-4646 stem-loop
Stem-loop 
a        a   gcu        u  cg   a 
 cugggaag gga   gagggaca ug  gag g
 |||||||| |||   |||||||| ||  ||| g
 gacccuuc ccu   cucccugu ac  cuc g
-        -   ---        u  -a   u
Get sequence
Deep sequencing
4 reads, 4 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr6: 31668806-31668868 [-]
sense
OTTHUMT00000268005 ; BAT5-005; intron 1
OTTHUMT00000076345 ; BAT5-004; intron 1
OTTHUMT00000355208 ; BAT5-015; intron 1
OTTHUMT00000268005 ; BAT5-005; intron 1
OTTHUMT00000076345 ; BAT5-004; intron 1
OTTHUMT00000355208 ; BAT5-015; intron 1
OTTHUMT00000268005 ; BAT5-005; intron 1
OTTHUMT00000076345 ; BAT5-004; intron 1
OTTHUMT00000355208 ; BAT5-015; intron 1
OTTHUMT00000076344 ; BAT5-002; intron 2
OTTHUMT00000355195 ; BAT5-014; intron 2
OTTHUMT00000076344 ; BAT5-002; intron 2
OTTHUMT00000355195 ; BAT5-014; intron 2
OTTHUMT00000076344 ; BAT5-002; intron 2
OTTHUMT00000355195 ; BAT5-014; intron 2
OTTHUMT00000076342 ; BAT5-001; intron 3
OTTHUMT00000076343 ; BAT5-003; intron 3
OTTHUMT00000355209 ; BAT5-016; intron 3
OTTHUMT00000076342 ; BAT5-001; intron 3
OTTHUMT00000076343 ; BAT5-003; intron 3
OTTHUMT00000355209 ; BAT5-016; intron 3
OTTHUMT00000076342 ; BAT5-001; intron 3
OTTHUMT00000076343 ; BAT5-003; intron 3
OTTHUMT00000355209 ; BAT5-016; intron 3
OTTHUMT00000328320 ; XXbac-BPG32J3.20-001; intron 5
OTTHUMT00000328320 ; XXbac-BPG32J3.20-001; intron 5
OTTHUMT00000328320 ; XXbac-BPG32J3.20-001; intron 5
ENST00000440843 ; ABHD16A-005; intron 1
ENST00000498420 ; ABHD16A-004; intron 1
ENST00000477462 ; ABHD16A-015; intron 1
ENST00000440843 ; ABHD16A-005; intron 1
ENST00000498420 ; ABHD16A-004; intron 1
ENST00000477462 ; ABHD16A-015; intron 1
ENST00000440843 ; ABHD16A-005; intron 1
ENST00000498420 ; ABHD16A-004; intron 1
ENST00000477462 ; ABHD16A-015; intron 1
ENST00000495769 ; ABHD16A-002; intron 2
ENST00000482224 ; ABHD16A-014; intron 2
ENST00000538874 ; ABHD16A-202; intron 2
ENST00000538874 ; ABHD16A-202; intron 2
ENST00000495769 ; ABHD16A-002; intron 2
ENST00000482224 ; ABHD16A-014; intron 2
ENST00000495769 ; ABHD16A-002; intron 2
ENST00000482224 ; ABHD16A-014; intron 2
ENST00000538874 ; ABHD16A-202; intron 2
ENST00000395952 ; ABHD16A-001; intron 3
ENST00000492084 ; ABHD16A-003; intron 3
ENST00000468037 ; ABHD16A-016; intron 3
ENST00000375842 ; ABHD16A-201; intron 3
ENST00000492084 ; ABHD16A-003; intron 3
ENST00000468037 ; ABHD16A-016; intron 3
ENST00000375842 ; ABHD16A-201; intron 3
ENST00000395952 ; ABHD16A-001; intron 3
ENST00000395952 ; ABHD16A-001; intron 3
ENST00000492084 ; ABHD16A-003; intron 3
ENST00000468037 ; ABHD16A-016; intron 3
ENST00000375842 ; ABHD16A-201; intron 3
ENST00000461287 ; LY6G6E-001; intron 5
ENST00000461287 ; LY6G6E-001; intron 5
ENST00000461287 ; LY6G6E-001; intron 5
Database links

Mature sequence hsa-miR-4646-5p

Accession MIMAT0019707
Sequence

1 -  

acugggaagaggagcugaggga

 - 22

Get sequence
Deep sequencing 3 reads, 3 experiments
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4646-3p

Accession MIMAT0019708
Sequence

43 -  

auugucccucucccuucccag

 - 63

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).