Stem-loop sequence hsa-mir-4644

Accession MI0017271
Description Homo sapiens miR-4644 stem-loop
Stem-loop 
     g  g  -   c      -   ca     -c   gucc 
gcggc gu cu cug cucuuu cuc  uccac  cug    a
||||| || || ||| |||||| |||  |||||  |||    g
ugccg ua ga gac gagaaa gag  aggug  gac    g
     g  g  a   a      a   ag     ac   accu
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr6: 170639849-170639932 [+]
sense
OTTHUMT00000043259 ; FAM120B-001; intron 4
OTTHUMT00000043261 ; FAM120B-003; intron 4
OTTHUMT00000043259 ; FAM120B-001; intron 4
OTTHUMT00000043261 ; FAM120B-003; intron 4
OTTHUMT00000043259 ; FAM120B-001; intron 4
OTTHUMT00000043261 ; FAM120B-003; intron 4
ENST00000252510 ; FAM120B-201; intron 2
ENST00000252510 ; FAM120B-201; intron 2
ENST00000252510 ; FAM120B-201; intron 2
ENST00000537664 ; FAM120B-202; intron 4
ENST00000540480 ; FAM120B-203; intron 4
ENST00000476287 ; FAM120B-001; intron 4
ENST00000366751 ; FAM120B-003; intron 4
ENST00000366751 ; FAM120B-003; intron 4
ENST00000476287 ; FAM120B-001; intron 4
ENST00000540480 ; FAM120B-203; intron 4
ENST00000537664 ; FAM120B-202; intron 4
ENST00000366751 ; FAM120B-003; intron 4
ENST00000476287 ; FAM120B-001; intron 4
ENST00000540480 ; FAM120B-203; intron 4
ENST00000537664 ; FAM120B-202; intron 4
Database links

Mature sequence hsa-miR-4644

Accession MIMAT0019704
Sequence

53 -  

uggagagagaaaagagacagaag

 - 75

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).