Stem-loop sequence hsa-mir-4641

AccessionMI0017268 (change log)
Symbol HGNC:MIR4641
DescriptionHomo sapiens miR-4641 stem-loop
Literature search

1 open access papers mention hsa-mir-4641
(1 sentences)

Stem-loop
   gg      --  --g    ga         -a  a 
5'   ggggca  gg   ggca  gggcaucag  gg c
     ||||||  ||   ||||  |||||||||  ||  
3'   cuccgu  uc   ccgu  cccgugguc  cc a
   ga      uu  aua    -a         cg  g 
Get sequence
Deep sequencing
54 reads, 33.3 reads per million, 30 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 41598723-41598788 [+]
intergenic
Database links

Mature sequence hsa-miR-4641

Accession MIMAT0019701
Sequence

42 - 

ugcccaugccauacuuuugccuca

 - 65

Get sequence
Deep sequencing45 reads, 25 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).