Stem-loop sequence hsa-mir-4641

Accession

MI0017268

Description

Homo sapiens miR-4641 stem-loop

Stem-loop

gg      --  --g    ga         -a  a 
  ggggca  gg   ggca  gggcaucag  gg c
  ||||||  ||   ||||  |||||||||  ||  
  cuccgu  uc   ccgu  cccgugguc  cc a
ga      uu  aua    -a         cg  g 

Deep sequencing

8 reads, 7 experiments

Genome context

• Coordinates (GRCh37.p5): chr6: 41566461-41566526 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000106767 ; FOXP4-002; intron 15

  OTTHUMT00000106767 ; FOXP4-002; intron 15

  OTTHUMT00000106767 ; FOXP4-002; intron 15

  OTTHUMT00000331294 ; FOXP4-006; intron 16

  OTTHUMT00000040512 ; FOXP4-001; intron 16

  OTTHUMT00000106560 ; FOXP4-003; intron 16

  OTTHUMT00000331294 ; FOXP4-006; intron 16

  OTTHUMT00000040512 ; FOXP4-001; intron 16

  OTTHUMT00000106560 ; FOXP4-003; intron 16

  OTTHUMT00000331294 ; FOXP4-006; intron 16

  OTTHUMT00000040512 ; FOXP4-001; intron 16

  OTTHUMT00000106560 ; FOXP4-003; intron 16

  ENST00000307972 ; FOXP4-002; intron 15

  ENST00000307972 ; FOXP4-002; intron 15

  ENST00000307972 ; FOXP4-002; intron 15

  ENST00000373060 ; FOXP4-201; intron 16

  ENST00000373057 ; FOXP4-003; intron 16

  ENST00000409208 ; FOXP4-006; intron 16

  ENST00000373063 ; FOXP4-001; intron 16

  ENST00000373063 ; FOXP4-001; intron 16

  ENST00000409208 ; FOXP4-006; intron 16

  ENST00000373057 ; FOXP4-003; intron 16

  ENST00000373060 ; FOXP4-201; intron 16

  ENST00000373063 ; FOXP4-001; intron 16

  ENST00000409208 ; FOXP4-006; intron 16

  ENST00000373057 ; FOXP4-003; intron 16

  ENST00000373060 ; FOXP4-201; intron 16

Database links

• ENTREZGENE: 100616178;MIR4641

Mature sequence hsa-miR-4641

• Accession: MIMAT0019701
• Sequence: 42 - ugcccaugccauacuuuugccuca - 65
• Deep sequencing: 2 reads, 1 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4641
  • MIRDB:hsa-miR-4641
  • TARGETMINER:hsa-miR-4641

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).