|
miRBase |
|
Stem-loop sequence hsa-mir-4638 |
|||||
| Accession | MI0017265 | ||||
| Description | Homo sapiens miR-4638 stem-loop | ||||
| Stem-loop |
-g - acaa uc -c gacuc gcugcggu gg g cgg uccaga ||||| |||||||| || | ||| ||||| a cuggg cggcgccg cc c gcc aggucc ga g --ga uc ac |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4638-5p |
|
| Accession | MIMAT0019695 |
| Sequence |
2 - acucggcugcgguggacaagu - 22 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
Mature sequence hsa-miR-4638-3p |
|
| Accession | MIMAT0019696 |
| Sequence |
35 - ccuggacaccgcucagccggccg - 57 |
| Deep sequencing | 4 reads, 2 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|