|
miRBase |
|
Stem-loop sequence hsa-mir-4637 |
|||||
| Accession | MI0017264 | ||||
| Description | Homo sapiens miR-4637 stem-loop | ||||
| Gene family | MIPF0001586; mir-4637 | ||||
| Stem-loop |
a uu ucaua u cccuuacuuggaucugca uuaguauu aa gauug a |||||||||||||||||| |||||||| || ||||| gggagugaacuuagacgu aaucauaa uu uugau u c uu --uga u |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4637 |
|
| Accession | MIMAT0019694 |
| Sequence |
60 - uacuaacugcagauucaaguga - 81 |
| Evidence | experimental; Solexa [1-2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
| 2 |
PMID:21606961
"Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia"
Leukemia. 25:1389-1399(2011).
|