Stem-loop sequence hsa-mir-4636

Accession MI0017263
Description Homo sapiens miR-4636 stem-loop
Stem-loop 
                   ca           ------   g 
uagauucagaacucguguu  aagccuuuagc      cca c
|||||||||||||||||||  |||||||||||      |||  
aucuaagucuugagcacga  uucggaaaucg      ggu a
                   ac           ugagag   a
Get sequence
Deep sequencing
34 reads, 7 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr5: 9053928-9054007 [-]
sense
OTTHUMT00000206989 ; SEMA5A-001; intron 19
OTTHUMT00000206989 ; SEMA5A-001; intron 19
OTTHUMT00000206989 ; SEMA5A-001; intron 19
ENST00000382496 ; SEMA5A-001; intron 19
ENST00000382496 ; SEMA5A-001; intron 19
ENST00000382496 ; SEMA5A-001; intron 19
Database links

Mature sequence hsa-miR-4636

Accession MIMAT0019693
Sequence

10 -  

aacucguguucaaagccuuuag

 - 31

Get sequence
Deep sequencing 9 reads, 3 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).