Stem-loop sequence hsa-mir-4635

Accession MI0017262
Description Homo sapiens miR-4635 stem-loop
Stem-loop 
                      cc  cuu      cgccg 
ccgggacuuuguggguucugac  ca   ggauca     a
||||||||||||||||||||||  ||   ||||||      
gguccugaaacgcccaagacug  gu   ucuggu     c
                      aa  ---      cacaa
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr5: 1063011-1063089 [-]
sense
OTTHUMT00000366451 ; SLC12A7-008; intron 1
OTTHUMT00000366451 ; SLC12A7-008; intron 1
OTTHUMT00000366451 ; SLC12A7-008; intron 1
OTTHUMT00000366450 ; SLC12A7-007; intron 5
OTTHUMT00000366450 ; SLC12A7-007; intron 5
OTTHUMT00000366450 ; SLC12A7-007; intron 5
OTTHUMT00000366446 ; SLC12A7-001; intron 20
OTTHUMT00000366446 ; SLC12A7-001; intron 20
OTTHUMT00000366446 ; SLC12A7-001; intron 20
ENST00000514994 ; SLC12A7-008; intron 1
ENST00000514994 ; SLC12A7-008; intron 1
ENST00000514994 ; SLC12A7-008; intron 1
ENST00000513223 ; SLC12A7-007; intron 5
ENST00000513223 ; SLC12A7-007; intron 5
ENST00000513223 ; SLC12A7-007; intron 5
ENST00000343658 ; SLC12A7-201; intron 6
ENST00000343658 ; SLC12A7-201; intron 6
ENST00000264930 ; SLC12A7-001; intron 20
ENST00000264930 ; SLC12A7-001; intron 20
ENST00000264930 ; SLC12A7-001; intron 20
Database links

Mature sequence hsa-miR-4635

Accession MIMAT0019692
Sequence

51 -  

ucuugaagucagaacccgcaa

 - 71

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).