Stem-loop sequence hsa-mir-4633

Accession

MI0017260

Description

Homo sapiens miR-4633 stem-loop

Stem-loop

u   aa u   c                          aa 
 ggc  g cuc gcauaugccuggcuagcuccuccaca  u
 |||  | ||| ||||||||||||||||||||||||||   
 cug  c gag cguauacggaccgaucgaggaggugu  g
a   -- -   a                          gc 

Deep sequencing

4 reads, 3 experiments

Genome context

• Coordinates (GRCh37.p5): chr5: 128433381-128433459 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000371827 ; ISOC1-002; intron 1

  OTTHUMT00000371826 ; ISOC1-001; intron 1

  OTTHUMT00000371827 ; ISOC1-002; intron 1

  OTTHUMT00000371826 ; ISOC1-001; intron 1

  OTTHUMT00000371827 ; ISOC1-002; intron 1

  OTTHUMT00000371826 ; ISOC1-001; intron 1

  OTTHUMT00000371828 ; ISOC1-003; intron 2

  OTTHUMT00000371829 ; ISOC1-004; intron 2

  OTTHUMT00000371828 ; ISOC1-003; intron 2

  OTTHUMT00000371829 ; ISOC1-004; intron 2

  OTTHUMT00000371828 ; ISOC1-003; intron 2

  OTTHUMT00000371829 ; ISOC1-004; intron 2

  ENST00000514194 ; ISOC1-002; intron 1

  ENST00000173527 ; ISOC1-001; intron 1

  ENST00000514194 ; ISOC1-002; intron 1

  ENST00000173527 ; ISOC1-001; intron 1

  ENST00000514194 ; ISOC1-002; intron 1

  ENST00000173527 ; ISOC1-001; intron 1

  ENST00000506986 ; ISOC1-003; intron 2

  ENST00000513879 ; ISOC1-004; intron 2

  ENST00000506986 ; ISOC1-003; intron 2

  ENST00000513879 ; ISOC1-004; intron 2

  ENST00000506986 ; ISOC1-003; intron 2

  ENST00000513879 ; ISOC1-004; intron 2

Database links

• ENTREZGENE: 100616175;MIR4633

Mature sequence hsa-miR-4633-5p

• Accession: MIMAT0019689
• Sequence: 15 - auaugccuggcuagcuccuc - 34
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4633-5p
  • MIRDB:hsa-miR-4633-5p
  • TARGETMINER:hsa-miR-4633-5p

Mature sequence hsa-miR-4633-3p

• Accession: MIMAT0019690
• Sequence: 50 - aggagcuagccaggcauaugca - 71
• Deep sequencing: 3 reads, 2 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4633-3p
  • MIRDB:hsa-miR-4633-3p
  • TARGETMINER:hsa-miR-4633-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).