|
miRBase |
|
Stem-loop sequence hsa-mir-4632 |
|||||
| Accession | MI0017259 | ||||
| Description | Homo sapiens miR-4632 stem-loop | ||||
| Stem-loop |
-g u u - - g agggcagcg ggg guggcgga gg ca g ||||||||| ||| |||||||| || || ucucgucgc cuc cgccguuu cc gu c ga u c g a g |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4632-5p |
|
| Accession | MIMAT0022977 |
| Sequence |
1 - gagggcagcguggguguggcgga - 23 |
| Deep sequencing | 1 reads, 1 experiments |
| Evidence | not experimental |
Mature sequence hsa-miR-4632-3p |
|
| Accession | MIMAT0019688 |
| Previous IDs | hsa-miR-4632 |
| Sequence |
40 - ugccgcccucucgcugcucuag - 61 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|