Stem-loop sequence osa-MIR2873b

AccessionMI0017257 (change log)
DescriptionOryza sativa miR2873b stem-loop
Gene family MIPF0001679; MIR2873
Literature search

2 open access papers mention osa-MIR2873b
(2 sentences)

Stem-loop
          cc       a             caa        ag   u           --c                aac 
5' uacauuc  accaaau ucaaguucaaacu   cuuuauuu  gag aacagaaaaga   auuuugggugaauggu   a
   |||||||  ||||||| |||||||||||||   ||||||||  ||| |||||||||||   ||||||||||||||||    
3' auguaag  ugguuua aguucagguuuga   gaaguaaa  cuc uuguuuuuucu   uaagauccacuuauca   u
          ua       g             auc        cu   u           cuu                cag 
Get sequence
Deep sequencing
186 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 18974743-18974902 [+]
intergenic
Database links

Mature sequence osa-miR2873b

Accession MIMAT0019685
Sequence

134 - 

uuggacuugagauuugguaug

 - 154

Get sequence
Deep sequencing183 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1