Stem-loop sequence osa-MIR3981

AccessionMI0017256 (change log)
DescriptionOryza sativa miR3981 stem-loop
Literature search

3 open access papers mention osa-MIR3981
(5 sentences)

Stem-loop
          a  a          a               u     ua     -    a    gg 
5' gaauaua ua cuuaaaaucg augggacguauccua uacua  agucu gaua gucu  a
   ||||||| || |||||||||| ||||||||||||||| |||||  ||||| |||| ||||  u
3' cuuauau gu ggauuuuggc uacucugcauaggau augau  uuaga cugu cgga  a
          c  g          c               u     gc     u    a    gu 
Get sequence
Deep sequencing
807 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 4302813-4302938 [+]
intergenic
Database links

Mature sequence osa-miR3981-5p

Accession MIMAT0019683
Sequence

24 - 

ugggacguauccuauuacuau

 - 44

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence osa-miR3981-3p

Accession MIMAT0019684
Sequence

85 - 

aguauuaggauacgucucauc

 - 105

Get sequence
Deep sequencing467 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1