Stem-loop sequence osa-MIR812n

AccessionMI0017254 (change log)
DescriptionOryza sativa miR812n stem-loop
Gene family MIPF0000345; MIR812
Literature search

10 open access papers mention osa-MIR812n
(16 sentences)

Stem-loop
   c                g                 -     uc  c         a        u  u     uuucuauuguuauuagaugauaaaacau 
5'  uuaagugcagccauga uuuccgugcccaacuuu aucgu  gu uuauuugaa uuuuuuua ga uagua                            g
    |||||||||||||||| ||||||||||||||||| |||||  || ||||||||| |||||||| || |||||                             
3'  aauucacgucgguacu aaaggcacggguugaaa uagca  ca aauaaacuu aaaaaaau uu guuau                            a
   a                a                 c     ga  c         a        u  u     uuuuguauucaguguguauuucaugaua 
Get sequence
Deep sequencing
1639 reads, 200 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 14108082-14108284 [-]
intergenic
Database links

Mature sequence osa-miR812n-5p

Accession MIMAT0019679
Sequence

4 - 

aagugcagccaugaguuuccgugc

 - 27

Get sequence
Deep sequencing80 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence osa-miR812n-3p

Accession MIMAT0019680
Sequence

179 - 

acggaaaaucauggcugcacuuaa

 - 202

Get sequence
Deep sequencing790 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1