Stem-loop sequence osa-MIR3980b

AccessionMI0017253 (change log)
DescriptionOryza sativa miR3980b stem-loop
Gene family MIPF0001268; MIR3980
Literature search

4 open access papers mention osa-MIR3980b
(8 sentences)

                    uuca  -                    a      ggcgccuuccccuugagcucgggagacgcguucugcuuuggcuggg 
5' gcggcgucuuccucuuc    cc uuaggagaaucgacggccuc gucagg                                              g
   |||||||||||||||||    || |||||||||||||||||||| ||||||                                              g
3' cgccgcagaaggagaag    gg gauccucuuagcugccggag cggucc                                              c
                    ----  c                    c      ugcuucacagacugaggccacuacuacucccgggcggccucggacg 
Get sequence
Deep sequencing
233 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence osa-miR3980b-5p

Accession MIMAT0019677

31 - 


 - 51

Get sequence
Deep sequencing174 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence osa-miR3980b-3p

Accession MIMAT0019678

147 - 


 - 167

Get sequence
Deep sequencing32 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links
