Stem-loop sequence osa-MIR3980a

AccessionMI0017252 (change log)
DescriptionOryza sativa miR3980a stem-loop
Gene family MIPF0001268; MIR3980
Literature search

5 open access papers mention osa-MIR3980a
(11 sentences)

Stem-loop
                  ucu    c                    a      ggcgccuuccccuugagcucgggagacgcauucugcuuuggcuggg 
5' gcggcgucuuccucu   uccc uuaggagaaucgacggccuc gucagg                                              g
   |||||||||||||||   |||| |||||||||||||||||||| ||||||                                              g
3' cgccgcagaaggaga   aggg gauccucuuagcugccggag cggucc                                              c
                  ---    c                    c      ugcuucacagauuaaggccacugcuguucccgggcggccucggacg 
Get sequence
Deep sequencing
236 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence osa-miR3980a-5p

Accession MIMAT0019675
Sequence

31 - 

aaucgacggccucagucaggg

 - 51

Get sequence
Deep sequencing174 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence osa-miR3980a-3p

Accession MIMAT0019676
Sequence

147 - 

cuggccgaggccgucgauucu

 - 167

Get sequence
Deep sequencing32 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1