Stem-loop sequence osa-MIR3979

AccessionMI0017251 (change log)
DescriptionOryza sativa miR3979 stem-loop
Literature search

10 open access papers mention osa-MIR3979
(15 sentences)

Stem-loop
        u     -a      u              a     ----ugg    -u     u 
5' gguuu cuugg  ucucuc cucccuugaaggcu ucuca       aggu  ugaug a
   ||||| |||||  |||||| |||||||||||||| |||||       ||||  ||||| c
3' ccgaa gaacc  agagag gagggggcuuccga agagu       uccg  guuac a
        c     ga      -              a     caaagaa    uu     c 
Get sequence
Deep sequencing
233 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 19480150-19480263 [+]
intergenic
Database links

Mature sequence osa-miR3979-5p

Accession MIMAT0019673
Sequence

13 - 

ucucucucucccuugaaggc

 - 32

Get sequence
Deep sequencing81 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence osa-miR3979-3p

Accession MIMAT0019674
Sequence

85 - 

cuucgggggaggagagaagc

 - 104

Get sequence
Deep sequencing152 reads, 2 experiments
Evidence experimental; Illumina [1-3]
Database links

References

1
2
PMID:21791435 "Differential expression of the microRNAs in superior and inferior spikelets in rice (Oryza sativa)" Peng T, Lv Q, Zhang J, Li J, Du Y, Zhao Q J Exp Bot. 62:4943-4954(2011).
3
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).