Stem-loop sequence osa-MIR1862g

AccessionMI0017249 (change log)
DescriptionOryza sativa miR1862g stem-loop
Literature search

11 open access papers mention osa-MIR1862g
(14 sentences)

Stem-loop
              a   a     a    a           a     --         aacacg 
5' ccaaaauaaac aac ucgug uagg ugugacacauc uagua  acgagucug      u
   ||||||||||| ||| ||||| |||| ||||||||||| |||||  |||||||||      a
3' gguuuuauuug uug aguau auuu acacuguguag auuau  ugcuuagac      g
              g   g     g    a           g     gu         cuauaa 
Get sequence
Deep sequencing
2391 reads, 950 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 20340401-20340523 [-]
intergenic
Database links

Mature sequence osa-miR1862g

Accession MIMAT0019670
Sequence

104 - 

augagguugguuuauuuugg

 - 123

Get sequence
Deep sequencing1420 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1