Stem-loop sequence osa-MIR1862f

AccessionMI0017248 (change log)
DescriptionOryza sativa miR1862f stem-loop
Literature search

11 open access papers mention osa-MIR1862f
(14 sentences)

Stem-loop
   c                     aagaauggaguacauu 
5'  uuaaaauaaaccagccucgua                c
    |||||||||||||||||||||                u
3'  gguuuuauuugguuggaguau                a
   a                     auguacgaucaucacg 
Get sequence
Deep sequencing
1476 reads, 850 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence osa-miR1862f

Accession MIMAT0019669
Sequence

59 - 

augagguugguuuauuuugg

 - 78

Get sequence
Deep sequencing1476 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1