Stem-loop sequence osa-MIR812m

AccessionMI0017247 (change log)
DescriptionOryza sativa miR812m stem-loop
Gene family MIPF0000345; MIR812
Literature search

9 open access papers mention osa-MIR812m
(15 sentences)

Stem-loop
     uc   cg                       c             a        ----u      uauuuuuguu        auaa    a   g 
5' ag  aua  uuuccgcguccaacuuugaucgu cgucuuauuugaa uuuuuuua     aauuag          guuaugag    uaaa uau a
   ||  |||  ||||||||||||||||||||||| ||||||||||||| ||||||||     ||||||          ||||||||    |||| ||| a
3' uc  uau  aaaggcgcagguugaaauuggca gcagaauaaacuu aaaaaaau     uuaauu          cagugcuc    auuu aug u
     ga   ca                       a             a        uuuuu      --uuuguauu        ----    c   a 
Get sequence
Deep sequencing
8927 reads, 3.6e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 20574659-20574845 [+]
intergenic
Database links

Mature sequence osa-miR812m

Accession MIMAT0019668
Sequence

152 - 

acgaacgguuaaaguuggacgcgg

 - 175

Get sequence
Deep sequencing7596 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1