Stem-loop sequence osa-MIR812l

AccessionMI0017246 (change log)
DescriptionOryza sativa miR812l stem-loop
Gene family MIPF0000345; MIR812
Literature search

9 open access papers mention osa-MIR812l
(15 sentences)

Stem-loop
                                a     ua      ua                          uaauuuuuuuguaauuaauauuuuuguuguuauaagaugauaaaacaug 
5' aguacuuccuccguccuauuuuaagugca ccaua  uuuucg  uucaauuuugaucguucgucuuauuu                                                 c
   ||||||||||||||||||||||||||||| |||||  ||||||  ||||||||||||||||||||||||||                                                  
3' uuaugagggagguagggugaaauucacgu gguau  aaaggc  agguugaaauuggcaagcagaauaaa                                                 a
                                a     ua      gc                          uuuuuuuaaaaucuuuuuuaaauuuuguauucagugcgcauuuuaugau 
Get sequence
Deep sequencing
9737 reads, 4.05e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence osa-miR812l

Accession MIMAT0019667
Sequence

179 - 

acgaacgguuaaaguuggacgcgg

 - 202

Get sequence
Deep sequencing7990 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1