Stem-loop sequence osa-MIR812k

AccessionMI0017245 (change log)
DescriptionOryza sativa miR812k stem-loop
Gene family MIPF0000345; MIR812
Literature search

9 open access papers mention osa-MIR812k
(16 sentences)

Stem-loop
             u        c       ag        cu             c         u          uauaauuagcauuuuuguuguuaugagaugauaaaacau 
5' cuccguuuca aauaagug agccaug  uuuccgcg  caauuuugaucgu cgucuuauu gaaauuuuuu                                       g
   |||||||||| |||||||| |||||||  ||||||||  ||||||||||||| ||||||||| ||||||||||                                        
3' gaggcagagu uuauucac ucgguac  aaaggcgc  guugaaauuggca gcagaauaa uuuuaaaaaa                                       a
             u        a       ca        ag             a         u          cuuuuuuaaauuuuuguauucaguguucauuucaugaua 
Get sequence
Deep sequencing
9178 reads, 3.7e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence osa-miR812k

Accession MIMAT0019666
Sequence

171 - 

acgaacgguuaaaguuggacgcgg

 - 194

Get sequence
Deep sequencing7878 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1