Stem-loop sequence pma-mir-4631

AccessionMI0017242 (change log)
DescriptionPetromyzon marinus miR-4631 stem-loop
Stem-loop
   gau   u     g      -   uua    u   uauu 
5'    gca guugc ggccaa ugu   ccug gua    c
      ||| ||||| |||||| |||   |||| |||     
3'    cgu uagcg ccgguu gcg   ggac cgu    a
   ugu   u     a      u   -cc    -   uaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL476419.1: 296622-296696 [-]
intergenic
Database links

Mature sequence pma-miR-4631

Accession MIMAT0019665
Sequence

10 - 

ugcgggccaauguuuaccugug

 - 31

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).