Stem-loop sequence pma-mir-4604

AccessionMI0017215 (change log)
DescriptionPetromyzon marinus miR-4604 stem-loop
Stem-loop
   cuu   cu     ga    c   --      c g    agcaaac 
5'    guu  ggcug  gagg ugu  gagcag a gcac       c
      |||  |||||  |||| |||  |||||| | ||||        
3'    caa  ccggc  cuuc acg  cucguc u cgug       a
   uac   -u     uc    c   gg      - g    cacauga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL480374.1: 10994-11081 [-]
intergenic
Database links

Mature sequence pma-miR-4604

Accession MIMAT0019638
Sequence

51 - 

acgugcgucugcucgggcaccuuc

 - 74

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).