Stem-loop sequence pma-mir-4590

AccessionMI0017200 (change log)
DescriptionPetromyzon marinus miR-4590 stem-loop
Stem-loop
   gcc      c    -   c     gca      a    gacg g 
5'    gugggc cgug ggg gguuc   cgcucc ucug    g a
      |||||| |||| ||| |||||   |||||| ||||    |  
3'    uaccug gcgc ucc ccggg   gugagg gggc    c g
   ccc      u    g   a     ---      -    acaa a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-miR-4590

Accession MIMAT0019623
Sequence

51 - 

acgggggaguggggccaccugc

 - 72

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).