|
miRBase |
|
Stem-loop sequence pma-mir-4579 |
|
| Accession | MI0017189 |
| Description | Petromyzon marinus miR-4579 stem-loop |
| Stem-loop |
gaa gu - c ac c uc ag g cg ag cgg ag caccgc gagu ugu gu gcg || || ||| || |||||| |||| ||| || || a gc uc gcc uc guggug cuca gcg cg ugg acc ug a - -a - ga ga g |
Mature sequence pma-miR-4579 |
|
| Accession | MIMAT0019612 |
| Sequence |
53 - gagacucguggugacuccgacu - 74 |
| Evidence | experimental; 454 [1] |
References |
|
| 1 |
PMID:20959416
"microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate"
Proc Natl Acad Sci U S A. 107:19379-19383(2010).
|