Stem-loop sequence pma-mir-4570

AccessionMI0017180 (change log)
DescriptionPetromyzon marinus miR-4570 stem-loop
Stem-loop
   ccu             ac           uguaaacacu 
5'    gagugugucuaga  cauaguuuaac          a
      |||||||||||||  |||||||||||          u
3'    cuugcguaggucu  guaucaaguug          c
   uuu             au           uuaaaacuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL477899.1: 7547-7627 [-]
intergenic
Clustered miRNAs
< 10kb from pma-mir-4570
pma-mir-4574GL477899.1: 8221-8305 [-]
pma-mir-4570GL477899.1: 7547-7627 [-]
Database links

Mature sequence pma-miR-4570

Accession MIMAT0019602
Sequence

54 - 

uugaacuauguaucuggaugc

 - 74

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).