Stem-loop sequence pma-mir-4569

AccessionMI0017179 (change log)
DescriptionPetromyzon marinus miR-4569 stem-loop
Stem-loop
   cua    a  g      a      a       u  aucgca 
5'    cuuc cc ucccgc cuggcg gcgaauu ug      u
      |||| || |||||| |||||| ||||||| ||       
3'    gggg gg ggggcg gaccgc cgcuuag ac      a
   -gg    g  g      -      a       c  cccucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL476401.1: 318883-318964 [+]
intergenic
Database links

Mature sequence pma-miR-4569

Accession MIMAT0019601
Sequence

12 - 

ucccgcacuggcgagcgaauuu

 - 33

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).