Stem-loop sequence pma-mir-4565

AccessionMI0017175 (change log)
DescriptionPetromyzon marinus miR-4565 stem-loop
Stem-loop
   c a     u   -a       -cg    -uu    c   cgc 
5'  g ugggu gac  ugcgagc   gacc   ugcg cuc   u
    | ||||| |||  |||||||   ||||   |||| |||    
3'  c gcccg cug  acguuug   cugg   acgc gag   g
   a g     u   gg       uug    ugu    a   uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL476843.1: 220081-220163 [-]
intergenic
Database links

Mature sequence pma-miR-4565

Accession MIMAT0019597
Sequence

13 - 

augcgagccggaccuuugcgccu

 - 35

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).