|
miRBase |
|
Stem-loop sequence pma-mir-4557 |
|
| Accession | MI0017167 |
| Description | Petromyzon marinus miR-4557 stem-loop |
| Stem-loop |
gcg c aa ug c u ------u aa ucgucucu uguaga ugcuuccag a ugug c gg a |||||||| |||||| ||||||||| | |||| | || gguagagg auaucu acgaagguc u gcac g cc a gag u ga gu u c uuacgcu cg |
Mature sequence pma-miR-4557 |
|
| Accession | MIMAT0019589 |
| Sequence |
18 - aaaugcuuccagugacuguguc - 39 |
| Evidence | experimental; 454 [1] |
References |
|
| 1 |
PMID:20959416
"microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate"
Proc Natl Acad Sci U S A. 107:19379-19383(2010).
|