Stem-loop sequence pma-mir-4548

AccessionMI0017158 (change log)
DescriptionPetromyzon marinus miR-4548 stem-loop
Stem-loop
   cgg      gcga        -   gc      -  cau   g 
5'    ggcugu    gggcaggc cgg  ggggga gg   gcu c
      ||||||    |||||||| |||  |||||| ||   |||  
3'    ccgacg    cccguccg gcc  cccucu cc   cgg c
   cag      ----        u   ga      a  --u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL478432.1: 44731-44810 [-]
intergenic
Database links

Mature sequence pma-miR-4548

Accession MIMAT0019580
Sequence

48 - 

uccaucucccagccgugccugcc

 - 70

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).